Transcript: Mouse NM_001159354.1

Mus musculus membrane associated guanylate kinase, WW and PDZ domain containing 3 (Magi3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Magi3 (99470)
Length:
6581
CDS:
441..4871

Additional Resources:

NCBI RefSeq record:
NM_001159354.1
NBCI Gene record:
Magi3 (99470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037865 CCAGGAGTTATTCCTCATAAA pLKO.1 3066 CDS 100% 13.200 18.480 N MAGI3 n/a
2 TRCN0000333008 CCAGGAGTTATTCCTCATAAA pLKO_005 3066 CDS 100% 13.200 18.480 N MAGI3 n/a
3 TRCN0000421867 TGGCGAGAAGAGTCGACTAAA pLKO_005 4049 CDS 100% 13.200 18.480 N Magi3 n/a
4 TRCN0000412841 CAAGTCGTAGAAGTCCTAAAG pLKO_005 2349 CDS 100% 10.800 15.120 N Magi3 n/a
5 TRCN0000088584 CCTTACTTTATGCCGTGGTTA pLKO.1 1910 CDS 100% 4.950 6.930 N Magi3 n/a
6 TRCN0000435033 AGGAAGTTTGGAGACTATAAA pLKO_005 2471 CDS 100% 15.000 10.500 N Magi3 n/a
7 TRCN0000429548 CAGTTTCAGAAAGGATCAATT pLKO_005 804 CDS 100% 13.200 9.240 N Magi3 n/a
8 TRCN0000412341 CCGACATTCAGAGGAACATTT pLKO_005 4127 CDS 100% 13.200 9.240 N Magi3 n/a
9 TRCN0000088585 GCTGATGAATTGATGTGTATT pLKO.1 2757 CDS 100% 13.200 9.240 N Magi3 n/a
10 TRCN0000420453 TGGTGACCAGATCGTTGAAAT pLKO_005 3635 CDS 100% 13.200 9.240 N Magi3 n/a
11 TRCN0000088587 CTGCTGATGAATTGATGTGTA pLKO.1 2755 CDS 100% 4.950 3.465 N Magi3 n/a
12 TRCN0000088586 CCCTCAGTATGGAACATACTA pLKO.1 1499 CDS 100% 0.563 0.394 N Magi3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.