Transcript: Mouse NM_001159385.1

Mus musculus MAX-like protein X (Mlx), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mlx (21428)
Length:
1830
CDS:
37..771

Additional Resources:

NCBI RefSeq record:
NM_001159385.1
NBCI Gene record:
Mlx (21428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054361 GCTATTAAGAGAGGCTATGAT pLKO.1 304 CDS 100% 5.625 7.875 N Mlx n/a
2 TRCN0000287176 GCTATTAAGAGAGGCTATGAT pLKO_005 304 CDS 100% 5.625 7.875 N Mlx n/a
3 TRCN0000294552 ATGATGAGGACAGTGATTATC pLKO_005 206 CDS 100% 13.200 9.240 N Mlx n/a
4 TRCN0000329897 GTGTAGTGTCCAGAGCTAATA pLKO_005 146 CDS 100% 13.200 9.240 N MLX n/a
5 TRCN0000054362 GAAAGTGAACTATGAGCAAAT pLKO.1 507 CDS 100% 10.800 7.560 N Mlx n/a
6 TRCN0000287175 GAAAGTGAACTATGAGCAAAT pLKO_005 507 CDS 100% 10.800 7.560 N Mlx n/a
7 TRCN0000294617 GCAACACTTGGCTCAAGTTTG pLKO_005 1151 3UTR 100% 10.800 7.560 N Mlx n/a
8 TRCN0000054358 CCAGTCTTTCAACGCCTCTAT pLKO.1 624 CDS 100% 4.950 3.465 N Mlx n/a
9 TRCN0000054360 CGGTGTCCTTCATCAGTTGAA pLKO.1 735 CDS 100% 4.950 3.465 N Mlx n/a
10 TRCN0000287174 CGGTGTCCTTCATCAGTTGAA pLKO_005 735 CDS 100% 4.950 3.465 N Mlx n/a
11 TRCN0000015718 GCTGGTTTCTACTTGGTGTTT pLKO.1 879 3UTR 100% 4.950 3.465 N MLX n/a
12 TRCN0000329896 GCTGGTTTCTACTTGGTGTTT pLKO_005 879 3UTR 100% 4.950 3.465 N MLX n/a
13 TRCN0000054359 CCAGGTCAAGTTCAACGTCTT pLKO.1 579 CDS 100% 4.050 2.835 N Mlx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07040 pDONR223 100% 90.9% 98.3% None (many diffs) n/a
2 ccsbBroad304_07040 pLX_304 0% 90.9% 98.3% V5 (many diffs) n/a
3 TRCN0000467156 ACGTAATGGAGAAAGATACAATCC pLX_317 48.6% 90.9% 98.3% V5 (many diffs) n/a
Download CSV