Transcript: Human NM_001159387.2

Homo sapiens beta-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
B4GALNT2 (124872)
Length:
8657
CDS:
25..1545

Additional Resources:

NCBI RefSeq record:
NM_001159387.2
NBCI Gene record:
B4GALNT2 (124872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035639 CCGGAGTATTCGAGAGTATTA pLKO.1 864 CDS 100% 13.200 18.480 N B4GALNT2 n/a
2 TRCN0000035641 CGGAAGCTGTTGAAGTTCATT pLKO.1 628 CDS 100% 5.625 4.500 N B4GALNT2 n/a
3 TRCN0000035640 CCTCAAGATATTGGTCATAAT pLKO.1 57 CDS 100% 13.200 9.240 N B4GALNT2 n/a
4 TRCN0000035643 CAGGCTGAATTTGAACACTTT pLKO.1 349 CDS 100% 4.950 3.465 N B4GALNT2 n/a
5 TRCN0000035642 CTGGGAAATGTGTTCCAGTTT pLKO.1 1135 CDS 100% 4.950 2.970 N B4GALNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16083 pDONR223 0% 88.9% 88.6% None (many diffs) n/a
2 ccsbBroad304_16083 pLX_304 0% 88.9% 88.6% V5 (many diffs) n/a
3 TRCN0000481312 CTTGTACGGATAAGCTTGGGGCCG pLX_317 26% 88.9% 88.6% V5 (many diffs) n/a
4 ccsbBroadEn_09487 pDONR223 100% 88.8% 88.6% None (many diffs) n/a
5 ccsbBroad304_09487 pLX_304 0% 88.8% 88.6% V5 (many diffs) n/a
6 TRCN0000480085 TCTCTGAATCAGCCCCCAACATTA pLX_317 23.1% 88.8% 88.6% V5 (many diffs) n/a
Download CSV