Transcript: Human NM_001159491.2

Homo sapiens brain protein I3 (BRI3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
BRI3 (25798)
Length:
680
CDS:
111..407

Additional Resources:

NCBI RefSeq record:
NM_001159491.2
NBCI Gene record:
BRI3 (25798)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159491.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005342 GCCAACTCTATCGTGGTCGTA pLKO.1 315 CDS 100% 2.640 3.696 N BRI3 n/a
2 TRCN0000005343 CCCGCTATCCTGCCAACTCTA pLKO.1 304 CDS 100% 1.650 2.310 N BRI3 n/a
3 TRCN0000005345 ACAGGGATACCCACCCACCAT pLKO.1 249 CDS 100% 0.880 0.616 N BRI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159491.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07944 pDONR223 100% 74.9% 62.4% None (many diffs) n/a
2 ccsbBroad304_07944 pLX_304 0% 74.9% 62.4% V5 (many diffs) n/a
3 TRCN0000481485 TCGCATAATTGTACTGTGCAGGCG pLX_317 100% 74.9% 62.4% V5 (many diffs) n/a
Download CSV