Transcript: Human NM_001159524.1

Homo sapiens zinc finger protein 735 (ZNF735), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF735 (730291)
Length:
1239
CDS:
1..1239

Additional Resources:

NCBI RefSeq record:
NM_001159524.1
NBCI Gene record:
ZNF735 (730291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339040 ACCACTCCTCAAGCGGTACTA pLKO_005 668 CDS 100% 4.950 6.930 N ZNF735 n/a
2 TRCN0000339038 TCCTCGACTCTTAAGACACAT pLKO_005 1009 CDS 100% 4.950 3.960 N ZNF735 n/a
3 TRCN0000339039 CGTATCCTCAGCCCTCATTTA pLKO_005 921 CDS 100% 13.200 9.240 N ZNF735 n/a
4 TRCN0000338972 TAGACACAATGCAAGATATAC pLKO_005 519 CDS 100% 13.200 9.240 N ZNF735 n/a
5 TRCN0000338975 TGTTCTCCCTGGGTATGACTG pLKO_005 155 CDS 100% 4.050 2.835 N ZNF735 n/a
6 TRCN0000016513 CTCAAACCTTACTAGACATAA pLKO.1 759 CDS 100% 13.200 6.600 Y ZNF117 n/a
7 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1211 CDS 100% 13.200 6.600 Y Zfp934 n/a
8 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1211 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
9 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1211 CDS 100% 13.200 6.600 Y EG668616 n/a
10 TRCN0000019456 ACCTTACTAGACATAAGAGAA pLKO.1 764 CDS 100% 4.950 2.475 Y ZNF681 n/a
11 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1209 CDS 100% 4.950 2.475 Y ZNF254 n/a
12 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 132 CDS 100% 4.950 2.475 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15279 pDONR223 63.5% 90.9% 47.3% None (many diffs) n/a
Download CSV