Transcript: Mouse NM_001159579.1

Mus musculus ligand of numb-protein X 1 (Lnx1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lnx1 (16924)
Length:
2347
CDS:
274..2160

Additional Resources:

NCBI RefSeq record:
NM_001159579.1
NBCI Gene record:
Lnx1 (16924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115125 CCAAGGTTGTTTCACCTGATT pLKO.1 766 CDS 100% 4.950 6.930 N Lnx1 n/a
2 TRCN0000115124 CCCAAGGTTGTTTCACCTGAT pLKO.1 765 CDS 100% 4.050 5.670 N Lnx1 n/a
3 TRCN0000115123 CGGTAGAAGTACATCGGGTAT pLKO.1 2052 CDS 100% 4.050 5.670 N Lnx1 n/a
4 TRCN0000115122 CCGGTCTTTCAAGAAGATCAA pLKO.1 639 CDS 100% 4.950 3.465 N Lnx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468085 GTAGCGTAAGCGATGTAGCCATGT pLX_317 23.5% 84.9% 88.9% V5 (many diffs) n/a
2 ccsbBroadEn_10472 pDONR223 100% 84.7% 88.6% None (many diffs) n/a
3 ccsbBroad304_10472 pLX_304 0% 84.7% 88.6% V5 (many diffs) n/a
Download CSV