Transcript: Human NM_001159596.2

Homo sapiens basic, immunoglobulin-like variable motif containing (BIVM), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
BIVM (54841)
Length:
3126
CDS:
613..1458

Additional Resources:

NCBI RefSeq record:
NM_001159596.2
NBCI Gene record:
BIVM (54841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429175 TACTGAACAGCTGGCATTATA pLKO_005 1469 3UTR 100% 15.000 10.500 N BIVM n/a
2 TRCN0000435725 GATATTGTTACTGATCTAAAC pLKO_005 1054 CDS 100% 10.800 5.400 Y BIVM n/a
3 TRCN0000130597 CCCGTGGATTGAAAGATGAAT pLKO.1 851 CDS 100% 5.625 2.813 Y BIVM n/a
4 TRCN0000128700 CCGTCTCTACTAAACATACAA pLKO.1 2103 3UTR 100% 5.625 2.813 Y BIVM n/a
5 TRCN0000146354 CCACAGTATAAGACTTCTTGT pLKO.1 547 5UTR 100% 4.950 2.475 Y BIVM n/a
6 TRCN0000130467 GCTTTACATATTCTGGGCTTT pLKO.1 652 CDS 100% 4.050 2.025 Y BIVM n/a
7 TRCN0000175161 GCTTATATCTATCATTGCCAA pLKO.1 877 CDS 100% 2.640 1.320 Y Bivm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03466 pDONR223 100% 53.7% 53.7% None 0_1ins687;530_550del n/a
2 ccsbBroad304_03466 pLX_304 0% 53.7% 53.7% V5 0_1ins687;530_550del n/a
3 TRCN0000478072 GAGTGCCCCGGCTGTTTGGCGAGC pLX_317 23.6% 53.7% 53.7% V5 0_1ins687;530_550del n/a
Download CSV