Transcript: Mouse NM_001159769.2

Mus musculus nuclear receptor subfamily 5, group A, member 2 (Nr5a2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Nr5a2 (26424)
Length:
3635
CDS:
257..1756

Additional Resources:

NCBI RefSeq record:
NM_001159769.2
NBCI Gene record:
Nr5a2 (26424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025985 CCCACAACAGACTGAGAAATT pLKO.1 1597 CDS 100% 13.200 9.240 N Nr5a2 n/a
2 TRCN0000025966 GCAGAAGACTACCTGTACTAT pLKO.1 1667 CDS 100% 5.625 3.938 N Nr5a2 n/a
3 TRCN0000026050 CCCTATAATAACCTCCTCATT pLKO.1 1709 CDS 100% 4.950 3.465 N Nr5a2 n/a
4 TRCN0000025971 GCCTCAAGTTCAAGCGAAGAT pLKO.1 1075 CDS 100% 4.950 3.465 N Nr5a2 n/a
5 TRCN0000026039 GCGGGAGTTTGTATGTCTCAA pLKO.1 1465 CDS 100% 4.950 3.465 N Nr5a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00593 pDONR223 100% 82.7% 85.6% None (many diffs) n/a
2 ccsbBroad304_00593 pLX_304 0% 82.7% 85.6% V5 (many diffs) n/a
3 TRCN0000492135 TCCAGCTCACAGAAAAGCGCCCCC pLX_317 28.3% 82.7% 85.6% V5 (many diffs) n/a
Download CSV