Transcript: Mouse NM_001159963.1

Mus musculus F-box and leucine-rich repeat protein 5 (Fbxl5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fbxl5 (242960)
Length:
2855
CDS:
102..2174

Additional Resources:

NCBI RefSeq record:
NM_001159963.1
NBCI Gene record:
Fbxl5 (242960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249856 CAGCGCAGTCAGACCATATAT pLKO_005 312 CDS 100% 15.000 12.000 N Fbxl5 n/a
2 TRCN0000257951 ATCTTACCCAGACCGACATTT pLKO_005 1186 CDS 100% 13.200 10.560 N Fbxl5 n/a
3 TRCN0000004291 GCTGAAGATTTGGCTGATATT pLKO.1 1548 CDS 100% 13.200 9.240 N FBXL5 n/a
4 TRCN0000349614 GCTGAAGATTTGGCTGATATT pLKO_005 1548 CDS 100% 13.200 9.240 N FBXL5 n/a
5 TRCN0000249857 GGGATGAAGATGCCGATATAG pLKO_005 964 CDS 100% 13.200 9.240 N Fbxl5 n/a
6 TRCN0000249854 TGTAGTCAAGTCAGTACTAAG pLKO_005 783 CDS 100% 10.800 7.560 N Fbxl5 n/a
7 TRCN0000004294 GTCAGAACACTCCACAGGTAT pLKO.1 695 CDS 100% 4.950 3.465 N FBXL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08004 pDONR223 100% 90.4% 93.3% None (many diffs) n/a
2 ccsbBroad304_08004 pLX_304 0% 90.4% 93.3% V5 (many diffs) n/a
3 TRCN0000478007 TCGATCAACCTAAGCTTTCAGAGT pLX_317 18.5% 90.4% 93.3% V5 (many diffs) n/a
Download CSV