Transcript: Mouse NM_001160211.1

Mus musculus cornichon family AMPA receptor auxiliary protein 3 (Cnih3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Mus musculus (mouse)
Gene:
Cnih3 (72978)
Length:
2670
CDS:
799..1281

Additional Resources:

NCBI RefSeq record:
NM_001160211.1
NBCI Gene record:
Cnih3 (72978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001160211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109838 GCTGAGGAACATCGAACGCAT pLKO.1 957 CDS 100% 2.640 3.696 N Cnih3 n/a
2 TRCN0000109836 CGAGCTAAGAACGGATTTCAA pLKO.1 894 CDS 100% 5.625 4.500 N Cnih3 n/a
3 TRCN0000109839 GCACATAATCGCCTTTGACGA pLKO.1 876 CDS 100% 2.640 2.112 N Cnih3 n/a
4 TRCN0000109835 GCCAGCTTGTAGCTGATGAAA pLKO.1 1499 3UTR 100% 5.625 3.938 N Cnih3 n/a
5 TRCN0000109837 GTACTGCATGATTTACACCTT pLKO.1 1248 CDS 100% 2.640 1.848 N Cnih3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2386 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000178741 CACACACATACACACACACAA pLKO.1 2376 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05023 pDONR223 100% 91% 100% None (many diffs) n/a
2 ccsbBroad304_05023 pLX_304 0% 91% 100% V5 (many diffs) n/a
3 TRCN0000478456 ACGAACGCAACATTGTAGAGCCGA pLX_317 62.6% 91% 100% V5 (many diffs) n/a
Download CSV