Transcript: Mouse NM_001161411.1

Mus musculus trafficking protein particle complex 12 (Trappc12), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trappc12 (217449)
Length:
2911
CDS:
298..2040

Additional Resources:

NCBI RefSeq record:
NM_001161411.1
NBCI Gene record:
Trappc12 (217449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248991 TCGAGTCCCAGATGGTGAAAT pLKO_005 971 CDS 100% 13.200 10.560 N Trappc12 n/a
2 TRCN0000248992 AGCAAAGAGACAGGTCTTAAA pLKO_005 1581 CDS 100% 13.200 9.240 N Trappc12 n/a
3 TRCN0000216448 GGAGATACAATGAGCTCTAAT pLKO.1 1078 CDS 100% 13.200 9.240 N Trappc12 n/a
4 TRCN0000248990 ATCAACCAGACCTATACTATG pLKO_005 1847 CDS 100% 10.800 7.560 N Trappc12 n/a
5 TRCN0000248993 GTCTCACAACTTCGGAGATAA pLKO_005 483 CDS 100% 13.200 7.920 N Trappc12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11951 pDONR223 100% 17% 18.9% None (many diffs) n/a
2 ccsbBroad304_11951 pLX_304 0% 17% 18.9% V5 (many diffs) n/a
3 TRCN0000467963 GACTACTTTGTCCTTGACACGCTG pLX_317 37.7% 17% 18.9% V5 (many diffs) n/a
Download CSV