Transcript: Mouse NM_001161537.1

Mus musculus immunoglobulin superfamily containing leucine-rich repeat 2 (Islr2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Islr2 (320563)
Length:
4310
CDS:
617..2854

Additional Resources:

NCBI RefSeq record:
NM_001161537.1
NBCI Gene record:
Islr2 (320563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100027 CCACAACCTTATATCCAACTT pLKO.1 937 CDS 100% 4.950 6.930 N Islr2 n/a
2 TRCN0000100026 CCAGGAAATAAACGGCAACTA pLKO.1 2815 CDS 100% 4.950 3.465 N Islr2 n/a
3 TRCN0000100029 CCTCGCAAATGGCTCTCTGTT pLKO.1 1621 CDS 100% 4.950 3.465 N Islr2 n/a
4 TRCN0000100025 CCTTTCCTATAATGATCCAAA pLKO.1 3385 3UTR 100% 4.950 3.465 N Islr2 n/a
5 TRCN0000100028 GCATTCAACCAGAGCTCAGAT pLKO.1 2030 CDS 100% 4.950 3.465 N Islr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03836 pDONR223 100% 84.6% 89.4% None (many diffs) n/a
2 ccsbBroad304_03836 pLX_304 0% 84.6% 89.4% V5 (many diffs) n/a
3 TRCN0000477821 GCCTGAATCCTAGTTCCCCTCACC pLX_317 15.3% 84.6% 89.4% V5 (many diffs) n/a
Download CSV