Transcript: Mouse NM_001161768.1

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (Galnt6), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Galnt6 (207839)
Length:
5712
CDS:
389..2257

Additional Resources:

NCBI RefSeq record:
NM_001161768.1
NBCI Gene record:
Galnt6 (207839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093966 CGGCAATCAGTACTTTGAGTA pLKO.1 1981 CDS 100% 4.950 6.930 N Galnt6 n/a
2 TRCN0000093967 GCACATCGGTACCTATGATAA pLKO.1 1489 CDS 100% 0.000 0.000 N Galnt6 n/a
3 TRCN0000093968 CCTGACCTTCGGCTGGGAAAT pLKO.1 1366 CDS 100% 3.600 2.880 N Galnt6 n/a
4 TRCN0000035490 GCACAATGTCTACCCAGAGAT pLKO.1 1831 CDS 100% 4.950 3.465 N GALNT6 n/a
5 TRCN0000093964 CCTATGTCATTTGCACAGTTA pLKO.1 2623 3UTR 100% 4.950 2.970 N Galnt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07776 pDONR223 100% 87.1% 88.5% None (many diffs) n/a
2 ccsbBroad304_07776 pLX_304 0% 87.1% 88.5% V5 (many diffs) n/a
3 TRCN0000469872 TCTAGGTTCCCGGTCCCTTTTTAC pLX_317 20.6% 87.1% 88.5% V5 (many diffs) n/a
4 ccsbBroadEn_07777 pDONR223 100% 87% 88.4% None (many diffs) n/a
5 ccsbBroad304_07777 pLX_304 0% 87% 88.4% V5 (many diffs) n/a
6 TRCN0000466957 AGTAAACTATATCATTCACATCGA pLX_317 20.5% 87% 88.4% V5 (many diffs) n/a
Download CSV