Transcript: Mouse NM_001161816.1

Mus musculus predicted gene 15455 (Gm15455), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm15455 (433287)
Length:
3016
CDS:
235..2793

Additional Resources:

NCBI RefSeq record:
NM_001161816.1
NBCI Gene record:
Gm15455 (433287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161816.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233277 CTTCGCCTTCGTCGAGTTTAG pLKO_005 519 CDS 100% 10.800 5.400 Y RBM10 n/a
2 TRCN0000102553 CTGATCGTTCACAGGATGATA pLKO.1 290 CDS 100% 5.625 2.813 Y Rbm10 n/a
3 TRCN0000287105 CTGATCGTTCACAGGATGATA pLKO_005 290 CDS 100% 5.625 2.813 Y Rbm10 n/a
4 TRCN0000102551 GCCTCTGTGGACTTTGAACAA pLKO.1 2530 CDS 100% 4.950 2.475 Y Rbm10 n/a
5 TRCN0000102554 CGTCGAGTTTAGTCACTTGCA pLKO.1 528 CDS 100% 2.640 1.320 Y Rbm10 n/a
6 TRCN0000287160 CGTCGAGTTTAGTCACTTGCA pLKO_005 528 CDS 100% 2.640 1.320 Y Rbm10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161816.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07212 pDONR223 100% 88.2% 92.6% None (many diffs) n/a
2 ccsbBroad304_07212 pLX_304 0% 88.2% 92.6% V5 (many diffs) n/a
3 TRCN0000469381 GTGCCTAGGCTACGGACCGCAGTC pLX_317 17.8% 88.2% 92.6% V5 (many diffs) n/a
4 ccsbBroadEn_01876 pDONR223 100% 81.1% 85.1% None (many diffs) n/a
5 ccsbBroad304_01876 pLX_304 0% 81.1% 85.1% V5 (many diffs) n/a
6 TRCN0000478287 AGTACTAGGAAGAAAGTAGAGATA pLX_317 9.8% 81.1% 85.1% V5 (many diffs) n/a
Download CSV