Transcript: Mouse NM_001162477.1

Mus musculus growth factor receptor bound protein 2-associated protein 2 (Gab2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gab2 (14389)
Length:
6005
CDS:
76..2073

Additional Resources:

NCBI RefSeq record:
NM_001162477.1
NBCI Gene record:
Gab2 (14389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001162477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100125 CCAGCCTACTTTATTCACGTT pLKO.1 573 CDS 100% 2.640 3.696 N Gab2 n/a
2 TRCN0000100128 CGCTGGTTTATACTTCGGAGT pLKO.1 169 CDS 100% 2.160 1.728 N Gab2 n/a
3 TRCN0000100127 CCGACACAATACAGAATTCAA pLKO.1 831 CDS 100% 0.000 0.000 N Gab2 n/a
4 TRCN0000415678 CTCTACTTGCACCAGTGCATA pLKO_005 655 CDS 100% 4.950 3.465 N GAB2 n/a
5 TRCN0000100129 TGGACAATATGGATGTCCCAA pLKO.1 998 CDS 100% 0.264 0.185 N Gab2 n/a
6 TRCN0000100126 CCTGAGAAACAACACTGTCAT pLKO.1 1629 CDS 100% 4.950 2.970 N Gab2 n/a
7 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5567 3UTR 100% 4.950 2.475 Y ERN2 n/a
8 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5567 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5567 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5569 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5569 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02260 pDONR223 100% 87.2% 91.7% None (many diffs) n/a
2 ccsbBroad304_02260 pLX_304 0% 87.2% 91.7% V5 (many diffs) n/a
3 TRCN0000491402 AAACCAATAGCTCTAAGTCGGAGC pLX_317 15.1% 87.2% 91.7% V5 (many diffs) n/a
4 TRCN0000488960 CCGCACTGGTTTAATACCTCTCGT pLX_317 18.3% 87.2% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV