Transcript: Mouse NM_001162846.1

Mus musculus phytanoyl-CoA hydroxylase interacting protein-like (Phyhipl), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Mus musculus (mouse)
Gene:
Phyhipl (70911)
Length:
2723
CDS:
170..1162

Additional Resources:

NCBI RefSeq record:
NM_001162846.1
NBCI Gene record:
Phyhipl (70911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001162846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249025 TATGTACACGGCTTATCATTA pLKO_005 850 CDS 100% 13.200 18.480 N Phyhipl n/a
2 TRCN0000257850 TAATTGCAGCATGAGTTAAAT pLKO_005 1548 3UTR 100% 15.000 10.500 N Phyhipl n/a
3 TRCN0000249024 ACCACGCCCAGGATGTCATTT pLKO_005 999 CDS 100% 13.200 9.240 N Phyhipl n/a
4 TRCN0000249026 GCAGCGCCTTCCTCAACTAAA pLKO_005 922 CDS 100% 13.200 9.240 N Phyhipl n/a
5 TRCN0000174821 GCCAAACATAACAAGACAGTT pLKO.1 1412 3UTR 100% 4.950 3.465 N Phyhipl n/a
6 TRCN0000175807 GTGAGAGAACACTATGGGAAT pLKO.1 623 CDS 100% 4.050 2.835 N Phyhipl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12821 pDONR223 100% 91.7% 97.8% None (many diffs) n/a
2 ccsbBroad304_12821 pLX_304 0% 91.7% 97.8% V5 (many diffs) n/a
3 TRCN0000467815 AGGGAGCTCCCAACTCAGTTTGGA pLX_317 35% 91.7% 97.8% V5 (many diffs) n/a
Download CSV