Transcript: Mouse NM_001163085.2

Mus musculus mitogen-activated protein kinase kinase kinase 15 (Map3k15), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Map3k15 (270672)
Length:
4348
CDS:
1..3996

Additional Resources:

NCBI RefSeq record:
NM_001163085.2
NBCI Gene record:
Map3k15 (270672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163085.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078990 CGGCTTAACTTCTGGTTAGAT pLKO.1 1534 CDS 100% 5.625 7.875 N Map3k15 n/a
2 TRCN0000078991 CGGATCAAATTCCGTATGGAT pLKO.1 817 CDS 100% 3.000 4.200 N Map3k15 n/a
3 TRCN0000078988 GTACTCACAAACTCCGAGTTT pLKO.1 4062 3UTR 100% 4.950 3.465 N Map3k15 n/a
4 TRCN0000078992 GCCATCCTTTACAGAATCCTT pLKO.1 3055 CDS 100% 3.000 2.100 N Map3k15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163085.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15322 pDONR223 62.5% 48.3% .5% None (many diffs) n/a
2 ccsbBroad304_15322 pLX_304 0% 48.3% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469461 TCCCAATGAACGACCGTCGGTTCC pLX_317 15.9% 48.3% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV