Transcript: Mouse NM_001163430.1

Mus musculus sirtuin 6 (Sirt6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Sirt6 (50721)
Length:
1668
CDS:
486..1370

Additional Resources:

NCBI RefSeq record:
NM_001163430.1
NBCI Gene record:
Sirt6 (50721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368637 CAAGTGTAAGACGCAGTACGT pLKO_005 791 CDS 100% 2.640 3.696 N SIRT6 n/a
2 TRCN0000108931 GCATGTTTCGTATAAGTCCAA pLKO.1 1286 CDS 100% 2.640 3.696 N Sirt6 n/a
3 TRCN0000108934 AGAGGAATGTCCCAAGTGTAA pLKO.1 779 CDS 100% 4.950 3.465 N Sirt6 n/a
4 TRCN0000108932 GTTTGACACCACCTTCGAGAA pLKO.1 608 CDS 100% 4.050 2.835 N Sirt6 n/a
5 TRCN0000108933 TCCCAAGTGTAAGACGCAGTA pLKO.1 788 CDS 100% 4.050 2.835 N Sirt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03332 pDONR223 100% 69.1% 72.1% None (many diffs) n/a
2 ccsbBroad304_03332 pLX_304 0% 69.1% 72.1% V5 (many diffs) n/a
3 TRCN0000471239 GCAATTGCAGTTCTACACTCACTC pLX_317 44.8% 69.1% 72.1% V5 (many diffs) n/a
Download CSV