Transcript: Mouse NM_001163476.1

Mus musculus GINS complex subunit 1 (Psf1 homolog) (Gins1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gins1 (69270)
Length:
677
CDS:
126..617

Additional Resources:

NCBI RefSeq record:
NM_001163476.1
NBCI Gene record:
Gins1 (69270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238688 CGGAGTGGTTCAACCATTATA pLKO_005 457 CDS 100% 15.000 21.000 N Gins1 n/a
2 TRCN0000238684 ATCTGATACCAACCGTCAAAT pLKO_005 295 CDS 100% 13.200 10.560 N Gins1 n/a
3 TRCN0000238687 ATGACCGGTTGCTTCGGATTA pLKO_005 367 CDS 100% 10.800 8.640 N Gins1 n/a
4 TRCN0000127531 CAAGTTCTGGAGGAGATGAAA pLKO.1 216 CDS 100% 5.625 3.375 N GINS1 n/a
5 TRCN0000129957 GAGGAGATGAAAGCTTTGTAT pLKO.1 225 CDS 100% 5.625 3.375 N GINS1 n/a
6 TRCN0000129421 CAGACAAGTTCTGGAGGAGAT pLKO.1 212 CDS 100% 4.050 2.430 N GINS1 n/a
7 TRCN0000278909 CAGACAAGTTCTGGAGGAGAT pLKO_005 212 CDS 100% 4.050 2.430 N GINS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07495 pDONR223 100% 71.3% 72.4% None (many diffs) n/a
2 ccsbBroad304_07495 pLX_304 0% 71.3% 72.4% V5 (many diffs) n/a
3 TRCN0000476112 AGCCATAGGTCTTTCACCCCAACT pLX_317 62.8% 71.3% 72.4% V5 (many diffs) n/a
Download CSV