Transcript: Mouse NM_001163537.1

Mus musculus DnaJ heat shock protein family (Hsp40) member C5 beta (Dnajc5b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dnajc5b (66326)
Length:
960
CDS:
134..733

Additional Resources:

NCBI RefSeq record:
NM_001163537.1
NBCI Gene record:
Dnajc5b (66326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115365 CGACACCATCCAGACAAGAAT pLKO.1 266 CDS 100% 5.625 7.875 N Dnajc5b n/a
2 TRCN0000115362 GCAACTGTTGTTGTGGACATT pLKO.1 531 CDS 100% 4.950 6.930 N Dnajc5b n/a
3 TRCN0000115364 CCAGCCTACAAATACAAATGA pLKO.1 661 CDS 100% 5.625 3.938 N Dnajc5b n/a
4 TRCN0000115363 CTGAACAATTTGGAGATGAAA pLKO.1 405 CDS 100% 5.625 3.938 N Dnajc5b n/a
5 TRCN0000115361 GCTGTGAACATATTCACATTT pLKO.1 818 3UTR 100% 1.320 0.924 N Dnajc5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04486 pDONR223 100% 89.6% 88.9% None (many diffs) n/a
2 ccsbBroad304_04486 pLX_304 0% 89.6% 88.9% V5 (many diffs) n/a
3 TRCN0000472112 GCCAGTCCGACTAGCATGACGTAC pLX_317 77.4% 89.6% 88.9% V5 (many diffs) n/a
Download CSV