Transcript: Mouse NM_001163750.1

Mus musculus splA/ryanodine receptor domain and SOCS box containing 3 (Spsb3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Spsb3 (79043)
Length:
1953
CDS:
7..1509

Additional Resources:

NCBI RefSeq record:
NM_001163750.1
NBCI Gene record:
Spsb3 (79043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248144 CCTTGCTGAGCTGTGATAATC pLKO_005 791 CDS 100% 13.200 18.480 N Spsb3 n/a
2 TRCN0000248145 AGGGAAGCCGTACTCCTATTT pLKO_005 1668 3UTR 100% 13.200 10.560 N Spsb3 n/a
3 TRCN0000248147 TTTGGCCAGGGCTCCATTATT pLKO_005 1084 CDS 100% 15.000 10.500 N Spsb3 n/a
4 TRCN0000248143 GAGTAGCAGGGCATGGCATTT pLKO_005 462 CDS 100% 10.800 7.560 N Spsb3 n/a
5 TRCN0000190859 CCTCAAGCAAGTGCTGCATAA pLKO.1 1356 CDS 100% 10.800 6.480 N Spsb3 n/a
6 TRCN0000248146 CCTCAAGCAAGTGCTGCATAA pLKO_005 1356 CDS 100% 10.800 6.480 N Spsb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09307 pDONR223 100% 58.9% 62.8% None (many diffs) n/a
2 ccsbBroad304_09307 pLX_304 0% 58.9% 62.8% V5 (many diffs) n/a
3 TRCN0000477665 ATGTGGAACCTGGCACAGTCAGGT pLX_317 39.7% 58.9% 62.8% V5 (many diffs) n/a
4 ccsbBroadEn_16060 pDONR223 0% 37.6% 40.1% None (many diffs) n/a
5 ccsbBroad304_16060 pLX_304 0% 37.6% 40.1% V5 (many diffs) n/a
Download CSV