Transcript: Mouse NM_001163815.1

Mus musculus vav 1 oncogene (Vav1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vav1 (22324)
Length:
4096
CDS:
99..2564

Additional Resources:

NCBI RefSeq record:
NM_001163815.1
NBCI Gene record:
Vav1 (22324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042609 GCTCTGAACGACGAAGATATT pLKO.1 429 CDS 100% 13.200 18.480 N Vav1 n/a
2 TRCN0000042610 CCATTAATCTTCGCGAGGTTA pLKO.1 187 CDS 100% 4.950 6.930 N Vav1 n/a
3 TRCN0000042611 GTGGAGGTCAAGCATATTAAA pLKO.1 2163 CDS 100% 15.000 10.500 N Vav1 n/a
4 TRCN0000042612 CTACAGCCAATGGGCATGATT pLKO.1 1558 CDS 100% 5.625 3.938 N Vav1 n/a
5 TRCN0000042608 CCACTTCTTAAAGGAACTGAA pLKO.1 770 CDS 100% 4.950 3.465 N Vav1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11216 pDONR223 100% 82.2% 87.6% None (many diffs) n/a
2 ccsbBroad304_11216 pLX_304 0% 82.2% 87.6% V5 (many diffs) n/a
3 TRCN0000474410 ACAGGATACCATCCAACCTGATTT pLX_317 20.3% 82.2% 87.6% V5 (many diffs) n/a
Download CSV