Transcript: Human NM_001163942.2

Homo sapiens ATP binding cassette subfamily B member 5 (ABCB5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ABCB5 (340273)
Length:
2269
CDS:
560..955

Additional Resources:

NCBI RefSeq record:
NM_001163942.2
NBCI Gene record:
ABCB5 (340273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060190 GCGGCATTATCGAGACCATAT pLKO.1 595 CDS 100% 10.800 8.640 N ABCB5 n/a
2 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1807 3UTR 100% 5.625 2.813 Y KLHL30 n/a
3 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1807 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05471 pDONR223 100% 15.9% 15.2% None (many diffs) n/a
2 ccsbBroad304_05471 pLX_304 0% 15.9% 15.2% V5 (many diffs) n/a
3 TRCN0000469819 GGACCCCGGTCGTTACTTTTCCAA pLX_317 20% 15.9% 15.2% V5 (many diffs) n/a
Download CSV