Transcript: Human NM_001164165.1

Homo sapiens GPR75-ASB3 readthrough (GPR75-ASB3), mRNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
GPR75-ASB3 (100302652)
Length:
2007
CDS:
106..1776

Additional Resources:

NCBI RefSeq record:
NM_001164165.1
NBCI Gene record:
GPR75-ASB3 (100302652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160443 CCTAATGCAACTACTTTAGAA pLKO.1 532 CDS 100% 5.625 2.813 Y ASB3 n/a
2 TRCN0000166388 CCCTGTTTACTCAGCAGTGTT pLKO.1 1065 CDS 100% 4.950 2.475 Y ASB3 n/a
3 TRCN0000159947 GAAACTACTTAACACAGCTAA pLKO.1 1783 3UTR 100% 4.950 2.475 Y ASB3 n/a
4 TRCN0000159844 GAAGGCAATGTTAAAGTCTTA pLKO.1 277 CDS 100% 4.950 2.475 Y ASB3 n/a
5 TRCN0000160879 GCAGCTTATCACAACTCTGTA pLKO.1 367 CDS 100% 4.950 2.475 Y ASB3 n/a
6 TRCN0000165009 GCTGGATTTGACCCACTGATT pLKO.1 1420 CDS 100% 4.950 2.475 Y ASB3 n/a
7 TRCN0000159743 GCTTATCACAACTCTGTAGAA pLKO.1 370 CDS 100% 4.950 2.475 Y ASB3 n/a
8 TRCN0000159225 CTAGAAATATTACTCCGGAAT pLKO.1 1105 CDS 100% 4.050 2.025 Y ASB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03223 pDONR223 100% 93.1% 93.1% None 1_114del n/a
2 ccsbBroad304_03223 pLX_304 0% 93.1% 93.1% V5 1_114del n/a
3 TRCN0000474116 CGATTCGGATACCGTCAAGCACCT pLX_317 29.9% 93.1% 93.1% V5 1_114del n/a
Download CSV