Transcript: Mouse NM_001164193.1

Mus musculus X-linked myotubular myopathy gene 1 (Mtm1), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mtm1 (17772)
Length:
770
CDS:
86..574

Additional Resources:

NCBI RefSeq record:
NM_001164193.1
NBCI Gene record:
Mtm1 (17772)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348844 TTGGAGAATGAATCCATTAAG pLKO_005 125 CDS 100% 13.200 10.560 N Mtm1 n/a
2 TRCN0000331439 CATCACAAATTATCGTCTTTA pLKO_005 277 CDS 100% 13.200 9.240 N Mtm1 n/a
3 TRCN0000355882 CATCACAAATTATCGTCTTTA pLKO_005 277 CDS 100% 13.200 9.240 N MTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06602 pDONR223 100% 23.4% 21.4% None (many diffs) n/a
2 ccsbBroad304_06602 pLX_304 0% 23.4% 21.4% V5 (many diffs) n/a
3 TRCN0000473224 TACAGGCAATACACCTGTCCTGGT pLX_317 28.9% 23.4% 21.4% V5 (many diffs) n/a
4 TRCN0000488963 AACAAACATTACAGCATACCTACG pLX_317 19.6% 23.4% 21.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV