Transcript: Human NM_001164386.2

Homo sapiens Rap guanine nucleotide exchange factor 6 (RAPGEF6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RAPGEF6 (51735)
Length:
8374
CDS:
200..5029

Additional Resources:

NCBI RefSeq record:
NM_001164386.2
NBCI Gene record:
RAPGEF6 (51735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435915 GATATCCCTGATCAAGTTATA pLKO_005 2438 CDS 100% 13.200 18.480 N RAPGEF6 n/a
2 TRCN0000047143 GCCTCCAATTATTCCACTCTT pLKO.1 3217 CDS 100% 4.950 6.930 N RAPGEF6 n/a
3 TRCN0000047147 GCTCAAACGAATGAAGATTAT pLKO.1 2971 CDS 100% 13.200 10.560 N RAPGEF6 n/a
4 TRCN0000438464 ACCGGTGCATCCGACACATAT pLKO_005 2558 CDS 100% 13.200 9.240 N RAPGEF6 n/a
5 TRCN0000047145 CCTCTACAATTCAGCCTTAAT pLKO.1 1820 CDS 100% 13.200 9.240 N RAPGEF6 n/a
6 TRCN0000047144 CCAGCAAGATTATTGGAGAAT pLKO.1 1315 CDS 100% 4.950 3.465 N RAPGEF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08342 pDONR223 100% 93% 92.8% None (many diffs) n/a
2 ccsbBroad304_08342 pLX_304 0% 93% 92.8% V5 (many diffs) n/a
3 TRCN0000481587 CCCCTTCTTGCTCGCATTGACCTG pLX_317 10.9% 93% 92.8% V5 (many diffs) n/a
Download CSV