Transcript: Human NM_001164460.1

Homo sapiens STEAP family member 1B (STEAP1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
STEAP1B (256227)
Length:
1299
CDS:
201..1229

Additional Resources:

NCBI RefSeq record:
NM_001164460.1
NBCI Gene record:
STEAP1B (256227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376743 CAGTGGCACTTGCCAATTAAA pLKO_005 408 CDS 100% 15.000 7.500 Y STEAP1B n/a
2 TRCN0000376666 GCTGTACTGCATGCAATTTAT pLKO_005 714 CDS 100% 15.000 7.500 Y STEAP1B n/a
3 TRCN0000365784 TGGAGAGAATTTCACTATATT pLKO_005 939 CDS 100% 15.000 7.500 Y STEAP1B n/a
4 TRCN0000370988 CTGTTGGCTGTGACATCTATT pLKO_005 894 CDS 100% 13.200 6.600 Y STEAP1B n/a
5 TRCN0000365781 TCATAATGGAACCAAGTATAA pLKO_005 623 CDS 100% 13.200 6.600 Y STEAP1B n/a
6 TRCN0000370923 CACTCTCTTGGCATTGGTTTA pLKO_005 569 CDS 100% 10.800 5.400 Y STEAP1B n/a
7 TRCN0000370986 TTTCCACATTGGTTGGATAAG pLKO_005 648 CDS 100% 10.800 5.400 Y STEAP1B n/a
8 TRCN0000161811 CCTGGATTGAGCATGATGTTT pLKO.1 820 CDS 100% 5.625 2.813 Y STEAP1 n/a
9 TRCN0000281175 CCTGGATTGAGCATGATGTTT pLKO_005 820 CDS 100% 5.625 2.813 Y STEAP1 n/a
10 TRCN0000161064 GAGGGAAGTAATTCACCCTTT pLKO.1 473 CDS 100% 4.050 2.025 Y STEAP1 n/a
11 TRCN0000281236 GAGGGAAGTAATTCACCCTTT pLKO_005 473 CDS 100% 4.050 2.025 Y STEAP1 n/a
12 TRCN0000164986 GCTGATGAATTTGACTGCCCT pLKO.1 354 CDS 100% 0.660 0.330 Y STEAP1 n/a
13 TRCN0000297943 GCTGATGAATTTGACTGCCCT pLKO_005 354 CDS 100% 0.660 0.330 Y STEAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09911 pDONR223 100% 70.7% 69% None (many diffs) n/a
2 ccsbBroad304_09911 pLX_304 0% 70.7% 69% V5 (many diffs) n/a
3 TRCN0000465389 TCACCAAACTGTGCCACGGGTCGA pLX_317 45.2% 70.7% 69% V5 (many diffs) n/a
Download CSV