Transcript: Human NM_001164501.2

Homo sapiens eukaryotic translation initiation factor 4E nuclear import factor 1 (EIF4ENIF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
EIF4ENIF1 (56478)
Length:
3664
CDS:
194..3151

Additional Resources:

NCBI RefSeq record:
NM_001164501.2
NBCI Gene record:
EIF4ENIF1 (56478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427854 GGATCACCGTCTTAGCGATAA pLKO_005 697 CDS 100% 10.800 15.120 N EIF4ENIF1 n/a
2 TRCN0000194361 CCTTATGTACAGACCTGTGTA pLKO.1 3474 3UTR 100% 4.950 6.930 N Eif4enif1 n/a
3 TRCN0000340296 CCTTATGTACAGACCTGTGTA pLKO_005 3474 3UTR 100% 4.950 6.930 N Eif4enif1 n/a
4 TRCN0000153716 CGCCAAAGTTATCAGTGTAGA pLKO.1 3109 CDS 100% 4.950 6.930 N EIF4ENIF1 n/a
5 TRCN0000151549 GAAGGTATAGTAGAGTGCAAT pLKO.1 977 CDS 100% 4.950 6.930 N EIF4ENIF1 n/a
6 TRCN0000152390 GCATTATGATGGAAGGATCTT pLKO.1 3297 3UTR 100% 4.950 6.930 N EIF4ENIF1 n/a
7 TRCN0000175849 GCTTCGATGATAGAAGATGTT pLKO.1 1151 CDS 100% 4.950 6.930 N Eif4enif1 n/a
8 TRCN0000340294 GCTTCGATGATAGAAGATGTT pLKO_005 1151 CDS 100% 4.950 6.930 N Eif4enif1 n/a
9 TRCN0000155201 GCCGTAACCAACAATCGACAA pLKO.1 1595 CDS 100% 4.050 5.670 N EIF4ENIF1 n/a
10 TRCN0000423445 CATGCTTGGCTTCGATGATAG pLKO_005 1143 CDS 100% 10.800 8.640 N EIF4ENIF1 n/a
11 TRCN0000175042 GAACAAGATTATCGACCTAAA pLKO.1 2531 CDS 100% 10.800 8.640 N Eif4enif1 n/a
12 TRCN0000154134 CCTAAGGGTTCTGAGGAAATA pLKO.1 3442 3UTR 100% 13.200 9.240 N EIF4ENIF1 n/a
13 TRCN0000153501 CAATCTTCTGAGTGGCCTTAT pLKO.1 1816 CDS 100% 10.800 7.560 N EIF4ENIF1 n/a
14 TRCN0000154055 CGTAAGATGTACGAGAGCAAA pLKO.1 2300 CDS 100% 4.950 3.465 N EIF4ENIF1 n/a
15 TRCN0000152806 GTCTGAATACAGGATGCACAA pLKO.1 3342 3UTR 100% 4.050 2.835 N EIF4ENIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08641 pDONR223 100% 99.9% 99.8% None 2474A>G n/a
2 ccsbBroad304_08641 pLX_304 0% 99.9% 99.8% V5 2474A>G n/a
3 ccsbBroadEn_08640 pDONR223 100% 82.1% 82.1% None (many diffs) n/a
4 ccsbBroad304_08640 pLX_304 0% 82.1% 82.1% V5 (many diffs) n/a
Download CSV