Transcript: Mouse NM_001164531.1

Mus musculus zinc finger, FYVE domain containing 27 (Zfyve27), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zfyve27 (319740)
Length:
5498
CDS:
104..1330

Additional Resources:

NCBI RefSeq record:
NM_001164531.1
NBCI Gene record:
Zfyve27 (319740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177662 CAAGCGTTACCCAACCAATAA pLKO.1 1111 CDS 100% 13.200 18.480 N Zfyve27 n/a
2 TRCN0000277137 CAAGCGTTACCCAACCAATAA pLKO_005 1111 CDS 100% 13.200 18.480 N Zfyve27 n/a
3 TRCN0000177788 CCTCTGTAGAAGGTGGTAATA pLKO.1 4726 3UTR 100% 13.200 18.480 N Zfyve27 n/a
4 TRCN0000277187 TGGGTCCTCGCCCTGTTAAAT pLKO_005 725 CDS 100% 15.000 12.000 N Zfyve27 n/a
5 TRCN0000277190 TTGGTTCTGCTCTATCCTATA pLKO_005 1521 3UTR 100% 10.800 8.640 N Zfyve27 n/a
6 TRCN0000277138 AGGAGTTCAAAGATGCAATTG pLKO_005 969 CDS 100% 10.800 7.560 N Zfyve27 n/a
7 TRCN0000181570 GCAATCAGACCCTGAGCAAAT pLKO.1 1308 CDS 100% 10.800 7.560 N Zfyve27 n/a
8 TRCN0000176488 CATCTTGTTCCTCACTTTGAA pLKO.1 346 CDS 100% 5.625 3.938 N Zfyve27 n/a
9 TRCN0000277189 CATCTTGTTCCTCACTTTGAA pLKO_005 346 CDS 100% 5.625 3.938 N Zfyve27 n/a
10 TRCN0000198561 GCCAGTGAACACTCCTTGAAT pLKO.1 4988 3UTR 100% 5.625 3.938 N Zfyve27 n/a
11 TRCN0000177020 GCCTTTAGAAAGAATGCACAT pLKO.1 3106 3UTR 100% 4.050 2.835 N Zfyve27 n/a
12 TRCN0000137843 GCAGATGCCTTTGTGTTCCTT pLKO.1 304 CDS 100% 3.000 2.100 N ZFYVE27 n/a
13 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 3360 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13072 pDONR223 100% 69.4% 71.8% None (many diffs) n/a
2 ccsbBroad304_13072 pLX_304 0% 69.4% 71.8% V5 (many diffs) n/a
3 TRCN0000473164 ACTATGTATCCCCCATGCCTCGCG pLX_317 41.5% 69.4% 71.8% V5 (many diffs) n/a
Download CSV