Transcript: Human NM_001164579.2

Homo sapiens modulator of smoothened (MOSMO), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
MOSMO (730094)
Length:
4469
CDS:
192..695

Additional Resources:

NCBI RefSeq record:
NM_001164579.2
NBCI Gene record:
MOSMO (730094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164579.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367189 AGTCGGAGGTCAACCTTATAA pLKO_005 566 CDS 100% 15.000 21.000 N BC030336 n/a
2 TRCN0000138175 GCGACAGTGTCAAACAATCCA pLKO.1 320 CDS 100% 3.000 4.200 N MOSMO n/a
3 TRCN0000367188 TCTGTATGGCTGCCCTAATAT pLKO_005 520 CDS 100% 15.000 10.500 N BC030336 n/a
4 TRCN0000376319 ACAGTAGTTGGGTCATCATAT pLKO_005 600 CDS 100% 13.200 9.240 N BC030336 n/a
5 TRCN0000367127 CTAAATCTCCTGAGCATATTC pLKO_005 935 3UTR 100% 13.200 9.240 N BC030336 n/a
6 TRCN0000367124 TTATCATCATGGGAATCATTT pLKO_005 403 CDS 100% 13.200 9.240 N BC030336 n/a
7 TRCN0000138352 CGTGCGACAGTGTCAAACAAT pLKO.1 317 CDS 100% 5.625 3.938 N MOSMO n/a
8 TRCN0000137353 GCTCCTATTGAACATACCCAA pLKO.1 3596 3UTR 100% 2.640 1.848 N MOSMO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164579.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13747 pDONR223 100% 50.7% 43.7% None (many diffs) n/a
2 ccsbBroad304_13747 pLX_304 0% 50.7% 43.7% V5 (many diffs) n/a
3 TRCN0000479456 ACGGGCATAAGCATTGTGAAACCG pLX_317 100% 50.7% 43.7% V5 (many diffs) n/a
Download CSV