Transcript: Mouse NM_001164583.1

Mus musculus DnaJ heat shock protein family (Hsp40) member C6 (Dnajc6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dnajc6 (72685)
Length:
5220
CDS:
76..2982

Additional Resources:

NCBI RefSeq record:
NM_001164583.1
NBCI Gene record:
Dnajc6 (72685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419591 ATGATAATGGGATTGCGTAAT pLKO_005 3334 3UTR 100% 10.800 15.120 N Dnajc6 n/a
2 TRCN0000009600 CCTGTGGATAGTGTTGACATA pLKO.1 475 CDS 100% 4.950 3.960 N Dnajc6 n/a
3 TRCN0000009597 CCAGTTTCATTCTGGGTTTAT pLKO.1 1209 CDS 100% 13.200 9.240 N Dnajc6 n/a
4 TRCN0000430703 TCCAAGTGACACTGGATATAG pLKO_005 1310 CDS 100% 13.200 9.240 N Dnajc6 n/a
5 TRCN0000009598 GCCTCGAACAATAGCTGAGAT pLKO.1 2637 CDS 100% 4.950 3.465 N Dnajc6 n/a
6 TRCN0000009599 CCTCTGAACATCACAGTCCAA pLKO.1 1099 CDS 100% 2.640 1.848 N Dnajc6 n/a
7 TRCN0000432838 GTGCGACCTACTTGCAGATAA pLKO_005 885 CDS 100% 13.200 7.920 N Dnajc6 n/a
8 TRCN0000419270 TACGTCACCTCCAGGATTATC pLKO_005 442 CDS 100% 13.200 7.920 N Dnajc6 n/a
9 TRCN0000009596 CCACCATAATTCCAAACCTAT pLKO.1 3755 3UTR 100% 4.950 2.475 Y Dnajc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11419 pDONR223 100% 87.5% 92.8% None (many diffs) n/a
2 ccsbBroad304_11419 pLX_304 0% 87.5% 92.8% V5 (many diffs) n/a
3 TRCN0000467752 GTAATATTCCAGCCTGGATTACCT pLX_317 13.5% 87.5% 92.8% V5 (many diffs) n/a
Download CSV