Transcript: Mouse NM_001164593.1

Mus musculus PDZ domain containing RING finger 4 (Pdzrn4), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Pdzrn4 (239618)
Length:
3956
CDS:
106..3150

Additional Resources:

NCBI RefSeq record:
NM_001164593.1
NBCI Gene record:
Pdzrn4 (239618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154468 GCTACCAGTTTCGGTAGAGTA pLKO.1 3185 3UTR 100% 0.495 0.693 N PDZRN4 n/a
2 TRCN0000154020 CGTGCCTTAAAGATCAAGGAA pLKO.1 2779 CDS 100% 3.000 2.100 N PDZRN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08146 pDONR223 100% 64.2% 65.8% None (many diffs) n/a
2 ccsbBroad304_08146 pLX_304 0% 64.2% 65.8% V5 (many diffs) n/a
3 TRCN0000476864 TGTTTCCGTTCTGCTCTACGGATA pLX_317 15.8% 64.2% 65.8% V5 (many diffs) n/a
Download CSV