Transcript: Mouse NM_001164671.2

Mus musculus DnaJ heat shock protein family (Hsp40) member A1 (Dnaja1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dnaja1 (15502)
Length:
3459
CDS:
226..1419

Additional Resources:

NCBI RefSeq record:
NM_001164671.2
NBCI Gene record:
Dnaja1 (15502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434119 CATATCTTGTGTAACTGATAA pLKO_005 1675 3UTR 100% 13.200 18.480 N Dnaja1 n/a
2 TRCN0000112227 GCCAATATCTACTCTTGACAA pLKO.1 1050 CDS 100% 4.950 6.930 N Dnaja1 n/a
3 TRCN0000112229 CGGCGTCATTATAATGGAGAA pLKO.1 1342 CDS 100% 4.050 5.670 N Dnaja1 n/a
4 TRCN0000156034 CCAGGTCAGATTGTCAAGCAT pLKO.1 1096 CDS 100% 3.000 4.200 N DNAJA1 n/a
5 TRCN0000433064 TGTATGACCCTTCATTGTTAA pLKO_005 1733 3UTR 100% 13.200 10.560 N Dnaja1 n/a
6 TRCN0000112228 GCAAAGAGAAAGGAGAGGTAA pLKO.1 519 CDS 100% 4.950 3.465 N Dnaja1 n/a
7 TRCN0000112225 GCCCTGTATGTATGATGACTT pLKO.1 1587 3UTR 100% 4.950 3.465 N Dnaja1 n/a
8 TRCN0000112226 CCACCCTGATAAGAATCCAAA pLKO.1 324 CDS 100% 4.950 2.475 Y Dnaja1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06405 pDONR223 100% 92.1% 99.4% None (many diffs) n/a
2 ccsbBroad304_06405 pLX_304 0% 92.1% 99.4% V5 (many diffs) n/a
3 TRCN0000479077 GGATTGTTCTTGCACGTTAGCGGC pLX_317 28.3% 92.1% 99.4% V5 (many diffs) n/a
Download CSV