Transcript: Human NM_001164712.2

Homo sapiens aminomethyltransferase (AMT), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
AMT (275)
Length:
1750
CDS:
24..1184

Additional Resources:

NCBI RefSeq record:
NM_001164712.2
NBCI Gene record:
AMT (275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034865 CCAAGATTGGTACTGTGACTA pLKO.1 1048 CDS 100% 4.950 6.930 N AMT n/a
2 TRCN0000034864 CGCTCTTTGACGTGTCTCATA pLKO.1 253 CDS 100% 4.950 6.930 N AMT n/a
3 TRCN0000232569 CACATTGCAAAGGGTAATAAC pLKO_005 1373 3UTR 100% 13.200 9.240 N AMT n/a
4 TRCN0000232567 AGAATGTGGCGATGGGTTATG pLKO_005 1096 CDS 100% 10.800 7.560 N AMT n/a
5 TRCN0000232565 ATATGCTGCAGACCAAGATAC pLKO_005 271 CDS 100% 10.800 7.560 N AMT n/a
6 TRCN0000232566 ATGACTTGATTGTAACCAATA pLKO_005 406 CDS 100% 10.800 7.560 N AMT n/a
7 TRCN0000034866 CCTGGCAACAGCTATTCTGAA pLKO.1 749 CDS 100% 4.950 3.465 N AMT n/a
8 TRCN0000034867 CCTTGTGTCGTCCACTTAGTT pLKO.1 85 CDS 100% 5.625 2.813 Y AMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10676 pDONR223 100% 74.8% 74.8% None 1_291del n/a
2 ccsbBroad304_10676 pLX_304 0% 74.8% 74.8% V5 1_291del n/a
3 TRCN0000467128 AAGAATATGTGGTAGTGCTTGATG pLX_317 48.1% 74.8% 74.8% V5 1_291del n/a
Download CSV