Transcript: Mouse NM_001164770.1

Mus musculus F-box and WD-40 domain protein 2 (Fbxw2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Fbxw2 (30050)
Length:
2813
CDS:
489..1466

Additional Resources:

NCBI RefSeq record:
NM_001164770.1
NBCI Gene record:
Fbxw2 (30050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298510 TCACGCAGTGCACAATCATTT pLKO_005 1577 3UTR 100% 13.200 9.240 N FBXW2 n/a
2 TRCN0000012813 GAACCAAAGTTCTCACCTAAA pLKO.1 1549 3UTR 100% 10.800 7.560 N Fbxw2 n/a
3 TRCN0000344974 GAACCAAAGTTCTCACCTAAA pLKO_005 1549 3UTR 100% 10.800 7.560 N Fbxw2 n/a
4 TRCN0000012814 CCTCTTCGTTAATTGGACATA pLKO.1 523 CDS 100% 4.950 3.465 N Fbxw2 n/a
5 TRCN0000345045 CCTCTTCGTTAATTGGACATA pLKO_005 523 CDS 100% 4.950 3.465 N Fbxw2 n/a
6 TRCN0000012815 CCTGGAGACTACATCCTCTTA pLKO.1 963 CDS 100% 4.950 3.465 N Fbxw2 n/a
7 TRCN0000353103 CCTGGAGACTACATCCTCTTA pLKO_005 963 CDS 100% 4.950 3.465 N Fbxw2 n/a
8 TRCN0000012817 CTGGTCTCTAAGCAGTGGAAT pLKO.1 345 5UTR 100% 4.950 3.465 N Fbxw2 n/a
9 TRCN0000345044 CTGGTCTCTAAGCAGTGGAAT pLKO_005 345 5UTR 100% 4.950 3.465 N Fbxw2 n/a
10 TRCN0000012816 CCACAGTATTCACCTGGTGTT pLKO.1 1427 CDS 100% 4.050 2.835 N Fbxw2 n/a
11 TRCN0000345046 CCACAGTATTCACCTGGTGTT pLKO_005 1427 CDS 100% 4.050 2.835 N Fbxw2 n/a
12 TRCN0000006546 GAACCAAAGTTCTCACCTAAT pLKO.1 1549 3UTR 100% 10.800 7.560 N FBXW2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02929 pDONR223 100% 67.8% 70.2% None (many diffs) n/a
2 ccsbBroad304_02929 pLX_304 0% 67.8% 70.2% V5 (many diffs) n/a
Download CSV