Transcript: Human NM_001164771.2

Homo sapiens solute carrier family 7 member 2 (SLC7A2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
SLC7A2 (6542)
Length:
7565
CDS:
49..2145

Additional Resources:

NCBI RefSeq record:
NM_001164771.2
NBCI Gene record:
SLC7A2 (6542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218641 ATTGGAATTGTGACGTCTTTG pLKO_005 1036 CDS 100% 10.800 15.120 N SLC7A2 n/a
2 TRCN0000042977 CGTGAGCTTTCTGGTAGGATT pLKO.1 1647 CDS 100% 4.950 6.930 N SLC7A2 n/a
3 TRCN0000042976 CGTATGTGATAGGTACATCAA pLKO.1 533 CDS 100% 4.950 3.960 N SLC7A2 n/a
4 TRCN0000230658 AGTCTAGAAGACACCAAATTA pLKO_005 238 CDS 100% 15.000 10.500 N SLC7A2 n/a
5 TRCN0000230661 TGACTACACTAAGCCTAATAA pLKO_005 3500 3UTR 100% 15.000 10.500 N SLC7A2 n/a
6 TRCN0000230659 GGCCTCTGCTATGCCGAATTT pLKO_005 415 CDS 100% 13.200 9.240 N SLC7A2 n/a
7 TRCN0000230660 TGTTTGCTTTATGGCCTATTT pLKO_005 1059 CDS 100% 13.200 9.240 N SLC7A2 n/a
8 TRCN0000042974 GCTGGGTTTGTGAAAGGAAAT pLKO.1 790 CDS 100% 10.800 7.560 N SLC7A2 n/a
9 TRCN0000042975 CCCTTCCTGTAGCGTTTGAAT pLKO.1 1139 CDS 100% 5.625 3.938 N SLC7A2 n/a
10 TRCN0000042973 GCCCAAATGTTCTCCTGAGAA pLKO.1 1494 CDS 100% 4.950 3.465 N SLC7A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11137 pDONR223 100% 91.4% 91.2% None (many diffs) n/a
2 ccsbBroad304_11137 pLX_304 0% 91.4% 91.2% V5 (many diffs) n/a
3 TRCN0000469007 ATGGTTTTTCTGTATGTTAGTTCC pLX_317 18.9% 91.4% 91.2% V5 (many diffs) n/a
Download CSV