Transcript: Human NM_001165931.1

Homo sapiens ribonucleotide reductase regulatory subunit M2 (RRM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-14
Taxon:
Homo sapiens (human)
Gene:
RRM2 (6241)
Length:
3452
CDS:
52..1401

Additional Resources:

NCBI RefSeq record:
NM_001165931.1
NBCI Gene record:
RRM2 (6241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293877 TGTACTCACAAGGCGATAATA pLKO_005 1805 3UTR 100% 15.000 21.000 N RRM2 n/a
2 TRCN0000054779 CCATGATATCTGGCAGATGTA pLKO.1 492 CDS 100% 4.950 3.960 N Rrm2 n/a
3 TRCN0000302301 CCATGATATCTGGCAGATGTA pLKO_005 492 CDS 100% 4.950 3.960 N Rrm2 n/a
4 TRCN0000038962 GCTCAAGAAACGAGGACTGAT pLKO.1 966 CDS 100% 4.950 3.960 N RRM2 n/a
5 TRCN0000286352 GCTCAAGAAACGAGGACTGAT pLKO_005 966 CDS 100% 4.950 3.960 N RRM2 n/a
6 TRCN0000038960 CGGAGGAGAGAGTAAGAGAAA pLKO.1 1085 CDS 100% 4.950 3.465 N RRM2 n/a
7 TRCN0000286354 CGGAGGAGAGAGTAAGAGAAA pLKO_005 1085 CDS 100% 4.950 3.465 N RRM2 n/a
8 TRCN0000038959 CCCATTTGACTTTATGGAGAA pLKO.1 1266 CDS 100% 4.050 2.835 N RRM2 n/a
9 TRCN0000286355 CCCATTTGACTTTATGGAGAA pLKO_005 1266 CDS 100% 4.050 2.835 N RRM2 n/a
10 TRCN0000038963 GCAGACAGACTTATGCTGGAA pLKO.1 1213 CDS 100% 2.640 1.848 N RRM2 n/a
11 TRCN0000286353 GCAGACAGACTTATGCTGGAA pLKO_005 1213 CDS 100% 2.640 1.848 N RRM2 n/a
12 TRCN0000042399 CGCTGTTTCTATGGCTTCCAA pLKO.1 706 CDS 100% 3.000 1.800 N Rrm2 n/a
13 TRCN0000038961 GCAGATGTATAAGAAGGCAGA pLKO.1 504 CDS 100% 2.160 1.296 N RRM2 n/a
14 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2736 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01466 pDONR223 100% 86.6% 86.6% None 1_180del n/a
2 ccsbBroad304_01466 pLX_304 0% 86.6% 86.6% V5 1_180del n/a
3 TRCN0000466948 TTTAAAGCAATGTTTATTCGGAAC pLX_317 29.9% 86.6% 86.6% V5 1_180del n/a
Download CSV