Transcript: Human NM_001165947.2

Homo sapiens 5-hydroxytryptamine receptor 2A (HTR2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HTR2A (3356)
Length:
4702
CDS:
244..1407

Additional Resources:

NCBI RefSeq record:
NM_001165947.2
NBCI Gene record:
HTR2A (3356)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357492 AGGACGATTCGAAGGTCTTTA pLKO_005 638 CDS 100% 13.200 18.480 N HTR2A n/a
2 TRCN0000009093 GCCACTAAGGTCAGTGTTATA pLKO.1 1899 3UTR 100% 13.200 18.480 N HTR2A n/a
3 TRCN0000357444 TTGCTTACTCGCCGATGATAA pLKO_005 669 CDS 100% 13.200 18.480 N HTR2A n/a
4 TRCN0000357493 GACCATATCAGTAGGTATATC pLKO_005 591 CDS 100% 13.200 9.240 N HTR2A n/a
5 TRCN0000009094 CCCTGCTCAATGTGTTTGTTT pLKO.1 1070 CDS 100% 5.625 3.938 N HTR2A n/a
6 TRCN0000009096 GCCTACAAGTCTAGCCAACTT pLKO.1 1243 CDS 100% 4.950 3.465 N HTR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488000 GTTGGTCTACTGTAAAAATCCTTC pLX_317 24.4% 78.5% 72.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488624 AAAATCAGCTTATGCATAATTCGT pLX_317 24.2% 78.5% 72.5% V5 (many diffs) n/a
Download CSV