Transcript: Mouse NM_001165971.1

Mus musculus heterogeneous nuclear ribonucleoprotein A1-like 2, pseudogene 2 (Hnrnpa1l2-ps2), mRNA.

Source:
NCBI, updated 2017-05-17
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpa1l2-ps2 (545091)
Length:
1165
CDS:
155..1117

Additional Resources:

NCBI RefSeq record:
NM_001165971.1
NBCI Gene record:
Hnrnpa1l2-ps2 (545091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001165971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313626 ACATCACCTACGAGATTATTT pLKO_005 508 CDS 100% 15.000 7.500 Y Hnrnpa1 n/a
2 TRCN0000313583 GATCTTTGTTGGTGGTATTAA pLKO_005 472 CDS 100% 15.000 7.500 Y Hnrnpa1 n/a
3 TRCN0000240125 GGCTTTGGGTTTGTCACATAT pLKO_005 320 CDS 100% 13.200 6.600 Y HNRNPA1P35 n/a
4 TRCN0000055265 CGCAGTGGTTCTGGAAACTTT pLKO.1 740 CDS 100% 5.625 2.813 Y Hnrnpa1 n/a
5 TRCN0000317546 CGCAGTGGTTCTGGAAACTTT pLKO_005 740 CDS 100% 5.625 2.813 Y Hnrnpa1 n/a
6 TRCN0000055264 GCCACAACTGTGAAGTAAGAA pLKO.1 669 CDS 100% 5.625 2.813 Y Hnrnpa1 n/a
7 TRCN0000055266 GCAATTACAACAATCAGTCTT pLKO.1 945 CDS 100% 4.950 2.475 Y Hnrnpa1 n/a
8 TRCN0000006585 TGTGGTAATGAGAGATCCAAA pLKO.1 283 CDS 100% 4.950 2.475 Y HNRNPA1 n/a
9 TRCN0000055267 GAAGAACATCACCTACGAGAT pLKO.1 503 CDS 100% 4.050 2.025 Y Hnrnpa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00765 pDONR223 100% 90.9% 95.6% None (many diffs) n/a
2 ccsbBroad304_00765 pLX_304 0% 90.9% 95.6% V5 (many diffs) n/a
3 TRCN0000473586 GGTGGCTTCAACTTACTCATTGAC pLX_317 46.7% 90.9% 95.6% V5 (many diffs) n/a
4 TRCN0000469731 CTTTTAGTCTATGACGTTTGCCAT pLX_317 70% 40.9% 42.5% V5 (many diffs) n/a
Download CSV