Transcript: Human NM_001166119.1

Homo sapiens lymphoid enhancer binding factor 1 (LEF1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
LEF1 (51176)
Length:
2660
CDS:
518..1429

Additional Resources:

NCBI RefSeq record:
NM_001166119.1
NBCI Gene record:
LEF1 (51176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428178 ATCCCGAGAACATCAAATAAA pLKO_005 716 CDS 100% 15.000 21.000 N LEF1 n/a
2 TRCN0000413476 ACGGTAACTTGGCTGCATTTG pLKO_005 1813 3UTR 100% 10.800 15.120 N LEF1 n/a
3 TRCN0000020160 CGGGTACATAATGATGCCAAA pLKO.1 649 CDS 100% 4.050 5.670 N LEF1 n/a
4 TRCN0000435673 GCTCATTCCCAACGTGCAAAG pLKO_005 1448 3UTR 100% 6.000 4.800 N LEF1 n/a
5 TRCN0000428355 GCTGGTCTGCAAGAGACAATT pLKO_005 1323 CDS 100% 13.200 9.240 N LEF1 n/a
6 TRCN0000416642 CATCCTCCAGCTCCTGATATC pLKO_005 872 CDS 100% 10.800 7.560 N LEF1 n/a
7 TRCN0000020161 CCACACTGACAGTGACCTAAT pLKO.1 1048 CDS 100% 10.800 7.560 N LEF1 n/a
8 TRCN0000020159 GCAGCTATCAACCAGATTCTT pLKO.1 1208 CDS 100% 5.625 3.938 N LEF1 n/a
9 TRCN0000020163 CCATCAGATGTCAACTCCAAA pLKO.1 836 CDS 100% 4.950 3.465 N LEF1 n/a
10 TRCN0000020162 GCACGGAAAGAAAGACAGCTA pLKO.1 1283 CDS 100% 2.640 1.848 N LEF1 n/a
11 TRCN0000360418 TCTGGAGATGGAAGCTTGTTG pLKO_005 1494 3UTR 100% 4.950 2.970 N Lef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03237 pDONR223 100% 75.8% 75.4% None (many diffs) n/a
2 ccsbBroad304_03237 pLX_304 0% 75.8% 75.4% V5 (many diffs) n/a
3 TRCN0000471255 AAGTACATCCGCGTCACCGTCCCA pLX_317 17.5% 75.8% 75.4% V5 (many diffs) n/a
Download CSV