Transcript: Human NM_001166158.1

Homo sapiens pyruvate dehydrogenase complex component X (PDHX), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PDHX (8050)
Length:
2310
CDS:
527..1351

Additional Resources:

NCBI RefSeq record:
NM_001166158.1
NBCI Gene record:
PDHX (8050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220390 GCTTACTTACTCCAATCATAA pLKO.1 960 CDS 100% 13.200 18.480 N PDHX n/a
2 TRCN0000330505 GCTTACTTACTCCAATCATAA pLKO_005 960 CDS 100% 13.200 18.480 N PDHX n/a
3 TRCN0000330506 TGCTGTATAAAGGGAATATTA pLKO_005 1606 3UTR 100% 15.000 10.500 N PDHX n/a
4 TRCN0000220388 CCAGCTCATAACAGTCACAAT pLKO.1 1237 CDS 100% 4.950 3.465 N PDHX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07197 pDONR223 100% 54.5% 54.4% None 63C>T;342_343ins681;428A>T n/a
2 ccsbBroad304_07197 pLX_304 0% 54.5% 54.4% V5 63C>T;342_343ins681;428A>T n/a
3 TRCN0000470522 CCAATATCTAAATGTCCTCGCCTC pLX_317 30.5% 54.5% 54.4% V5 63C>T;342_343ins681;428A>T n/a
Download CSV