Transcript: Human NM_001166245.1

Homo sapiens heparanase 2 (inactive) (HPSE2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
HPSE2 (60495)
Length:
4013
CDS:
74..1516

Additional Resources:

NCBI RefSeq record:
NM_001166245.1
NBCI Gene record:
HPSE2 (60495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431976 GTCGTGATACGGCACTCATTT pLKO_005 986 CDS 100% 13.200 18.480 N HPSE2 n/a
2 TRCN0000159951 GCACAAACAATCTATCCGATT pLKO.1 903 CDS 100% 4.050 5.670 N HPSE2 n/a
3 TRCN0000425509 GCTTATATGGCCCTAATATTG pLKO_005 636 CDS 100% 13.200 9.240 N HPSE2 n/a
4 TRCN0000158426 CCAAAGAGACTAAATGTCATA pLKO.1 1657 3UTR 100% 4.950 3.465 N HPSE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08799 pDONR223 100% 80.9% 80.7% None 445_446ins336;1204G>A;1400A>T n/a
2 ccsbBroad304_08799 pLX_304 0% 80.9% 80.7% V5 445_446ins336;1204G>A;1400A>T n/a
3 TRCN0000475450 ACTGCCGATATAGAACTCCATGTA pLX_317 23.1% 80.9% 80.7% V5 445_446ins336;1204G>A;1400A>T n/a
Download CSV