Transcript: Human NM_001166287.1

Homo sapiens repulsive guidance molecule BMP co-receptor a (RGMA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
RGMA (56963)
Length:
3174
CDS:
278..1582

Additional Resources:

NCBI RefSeq record:
NM_001166287.1
NBCI Gene record:
RGMA (56963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128608 CGACAATAATTACCTGAACGT pLKO.1 799 CDS 100% 2.640 3.696 N RGMA n/a
2 TRCN0000128983 GCTTAGAAAGTCGAAGTGCTT pLKO.1 2302 3UTR 100% 2.640 3.696 N RGMA n/a
3 TRCN0000425048 TGACTGGTGCCATGATGTTTG pLKO_005 1769 3UTR 100% 10.800 7.560 N RGMA n/a
4 TRCN0000418188 TGCCAGAGGAAGTGGTCAATG pLKO_005 1116 CDS 100% 10.800 7.560 N RGMA n/a
5 TRCN0000130653 CAAGATGCTCCACTCCAACAA pLKO.1 1432 CDS 100% 4.950 3.465 N RGMA n/a
6 TRCN0000425912 TGTTCTGCTAGACGCGTAGAT pLKO_005 1572 CDS 100% 4.950 3.465 N RGMA n/a
7 TRCN0000415762 AGTGCACGTGACAAGGTTGTG pLKO_005 1747 3UTR 100% 4.050 2.835 N RGMA n/a
8 TRCN0000128120 CTGCCATTACGAGAAGAGCTT pLKO.1 661 CDS 100% 2.640 1.848 N RGMA n/a
9 TRCN0000127524 CAGCCTGAAGATCACTGAGAA pLKO.1 1000 CDS 100% 4.950 2.970 N RGMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08678 pDONR223 100% 99.8% 99.7% None 1269C>G;1301G>C n/a
2 ccsbBroad304_08678 pLX_304 0% 99.8% 99.7% V5 1269C>G;1301G>C n/a
3 TRCN0000466660 AGCCGATCACTGAGGCTACCCGAG pLX_317 34.8% 99.8% 99.7% V5 1269C>G;1301G>C n/a
Download CSV