Transcript: Mouse NM_001166390.1

Mus musculus protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptp4a3 (19245)
Length:
2640
CDS:
324..788

Additional Resources:

NCBI RefSeq record:
NM_001166390.1
NBCI Gene record:
Ptp4a3 (19245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029873 AGTTCTACAATGACCCGGGAA pLKO.1 538 CDS 100% 2.160 3.024 N Ptp4a3 n/a
2 TRCN0000029870 CATCCAGTTCATCCGACAGAA pLKO.1 653 CDS 100% 4.950 3.465 N Ptp4a3 n/a
3 TRCN0000320048 CATCCAGTTCATCCGACAGAA pLKO_005 653 CDS 100% 4.950 3.465 N Ptp4a3 n/a
4 TRCN0000029872 CGCGTGTGTGAAGTGACCTAT pLKO.1 405 CDS 100% 4.950 3.465 N Ptp4a3 n/a
5 TRCN0000320047 CGCGTGTGTGAAGTGACCTAT pLKO_005 405 CDS 100% 4.950 3.465 N Ptp4a3 n/a
6 TRCN0000355597 GTGTGTGAAGTGACCTATGAC pLKO_005 408 CDS 100% 4.950 3.465 N PTP4A3 n/a
7 TRCN0000029869 CGGCCCAAAGATTTATTTATT pLKO.1 2422 3UTR 100% 15.000 7.500 Y Ptp4a3 n/a
8 TRCN0000319973 CGGCCCAAAGATTTATTTATT pLKO_005 2422 3UTR 100% 15.000 7.500 Y Ptp4a3 n/a
9 TRCN0000368291 AGCTCACCTACCTGGAGAAAT pLKO_005 700 CDS 100% 13.200 9.240 N PTP4A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02632 pDONR223 100% 64.5% 64.1% None (many diffs) n/a
2 ccsbBroad304_02632 pLX_304 0% 64.5% 64.1% V5 (many diffs) n/a
3 TRCN0000474068 CCAAGAGTACGCCGTGGATCCAGG pLX_317 100% 64.5% 64.1% V5 (many diffs) n/a
Download CSV