Transcript: Human NM_001166424.1

Homo sapiens progastricsin (PGC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PGC (5225)
Length:
1152
CDS:
68..1015

Additional Resources:

NCBI RefSeq record:
NM_001166424.1
NBCI Gene record:
PGC (5225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051848 CCCACAAGTATGATCCTGCTT pLKO.1 201 CDS 100% 2.640 3.696 N PGC n/a
2 TRCN0000051850 CCTGGTACCAACTTCGTCTAT pLKO.1 566 CDS 100% 0.000 0.000 N PGC n/a
3 TRCN0000378948 CTGAAGAAATTTAAGTCTATC pLKO_005 134 CDS 100% 10.800 6.480 N PGC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11029 pDONR223 100% 32.4% 30.8% None (many diffs) n/a
2 ccsbBroad304_11029 pLX_304 0% 32.4% 30.8% V5 (many diffs) n/a
3 TRCN0000465763 AGGGTAACTTACCGACTCCGGGCT pLX_317 84.9% 32.4% 30.8% V5 (many diffs) n/a
4 TRCN0000487898 ATGACGTATACCCGCATGTTATTG pLX_317 83.5% 32.4% 30.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV