Transcript: Mouse NM_001166456.1

Mus musculus solute carrier family 38, member 1 (Slc38a1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc38a1 (105727)
Length:
7059
CDS:
309..1766

Additional Resources:

NCBI RefSeq record:
NM_001166456.1
NBCI Gene record:
Slc38a1 (105727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069229 GCGACGAGTATATTCCAGGAA pLKO.1 496 CDS 100% 2.640 3.696 N Slc38a1 n/a
2 TRCN0000069228 CGGCCAGATAAATAGCAAGTT pLKO.1 416 CDS 100% 4.950 3.960 N Slc38a1 n/a
3 TRCN0000069231 CCTGGGAATGTCTGTCTTTAA pLKO.1 524 CDS 100% 13.200 9.240 N Slc38a1 n/a
4 TRCN0000069230 CCCTCCATGAAGGATATCTTT pLKO.1 1536 CDS 100% 5.625 3.938 N Slc38a1 n/a
5 TRCN0000069232 CTTTGCTATGTTTGTCATGTA pLKO.1 1247 CDS 100% 4.950 3.465 N Slc38a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14290 pDONR223 100% 84.2% 92.6% None (many diffs) n/a
2 ccsbBroad304_14290 pLX_304 0% 84.2% 92.6% V5 (many diffs) n/a
3 TRCN0000473078 GCGTTTCTGTTTATCTGACGGTTT pLX_317 28.2% 84.2% 92.6% V5 (many diffs) n/a
Download CSV