Transcript: Mouse NM_001166640.1

Mus musculus lysine acetyltransferase 14 (Kat14), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-31
Taxon:
Mus musculus (mouse)
Gene:
Kat14 (228714)
Length:
3265
CDS:
431..2386

Additional Resources:

NCBI RefSeq record:
NM_001166640.1
NBCI Gene record:
Kat14 (228714)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416788 ACCTTATATCAGGCGTGATTA pLKO_005 1834 CDS 100% 13.200 10.560 N KAT14 n/a
2 TRCN0000096469 GCCATTCTCTTCCCATACAAT pLKO.1 2634 3UTR 100% 5.625 3.938 N Kat14 n/a
3 TRCN0000096470 CCAAAGTATTATCAGCCCTTA pLKO.1 1795 CDS 100% 4.050 2.835 N Kat14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15945 pDONR223 0% 86.8% 94.6% None (many diffs) n/a
2 ccsbBroad304_15945 pLX_304 0% 86.8% 94.6% V5 (many diffs) n/a
3 TRCN0000478980 CCCTTCCTAACATGTATGTAACCC pLX_317 22.9% 86.8% 94.6% V5 (many diffs) n/a
4 ccsbBroadEn_03811 pDONR223 100% 72.6% 79.1% None (many diffs) n/a
5 ccsbBroad304_03811 pLX_304 0% 72.6% 79.1% V5 (many diffs) n/a
Download CSV