Transcript: Human NM_001167671.2

Homo sapiens LIM domain containing preferred translocation partner in lipoma (LPP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
LPP (4026)
Length:
18239
CDS:
190..2028

Additional Resources:

NCBI RefSeq record:
NM_001167671.2
NBCI Gene record:
LPP (4026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083287 GCCTACCTTTAATGTGCAGGT pLKO.1 843 CDS 100% 2.160 1.728 N LPP n/a
2 TRCN0000301081 GCCTACCTTTAATGTGCAGGT pLKO_005 843 CDS 100% 2.160 1.728 N LPP n/a
3 TRCN0000322958 CCCAACCAGGGACGCTATTAT pLKO_005 1060 CDS 100% 15.000 10.500 N LPP n/a
4 TRCN0000323036 GAAATCTCCATCCTATCATTT pLKO_005 2428 3UTR 100% 13.200 9.240 N LPP n/a
5 TRCN0000083283 CGCTATTATGAAGGCTACTAT pLKO.1 1072 CDS 100% 5.625 3.938 N LPP n/a
6 TRCN0000083286 GTCCGTATTGTGGCTTTGGAT pLKO.1 1846 CDS 100% 3.000 2.100 N LPP n/a
7 TRCN0000083285 CAGCCATTCTATGCTGTGGAA pLKO.1 1549 CDS 100% 2.640 1.848 N LPP n/a
8 TRCN0000083284 CCCTTCCATCTATCTCTGGAA pLKO.1 428 CDS 100% 0.264 0.185 N LPP n/a
9 TRCN0000301082 CCCTTCCATCTATCTCTGGAA pLKO_005 428 CDS 100% 0.264 0.185 N LPP n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7837 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 14288 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000178741 CACACACATACACACACACAA pLKO.1 14278 3UTR 100% 4.950 2.475 Y Cstad n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7837 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06536 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
2 ccsbBroad304_06536 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
3 TRCN0000475808 TCTACGACGATTGCGTAGTACTTG pLX_317 18.5% 99.7% 99.8% V5 (many diffs) n/a
Download CSV