Transcript: Mouse NM_001167694.2

Mus musculus G protein-coupled receptor 19 (Gpr19), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gpr19 (14760)
Length:
1693
CDS:
325..1572

Additional Resources:

NCBI RefSeq record:
NM_001167694.2
NBCI Gene record:
Gpr19 (14760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328128 CTATGTGGGCATTTCGGAAAT pLKO_005 1434 CDS 100% 10.800 15.120 N Gpr19 n/a
2 TRCN0000328129 GCAGTCACGTGGGTATCTTTC pLKO_005 1264 CDS 100% 10.800 15.120 N Gpr19 n/a
3 TRCN0000028165 CCGCTTCTATACCATCGTCTA pLKO.1 810 CDS 100% 4.050 5.670 N Gpr19 n/a
4 TRCN0000028162 CGCTTTGTGGTTGTTCTCCAT pLKO.1 543 CDS 100% 2.640 3.696 N Gpr19 n/a
5 TRCN0000328126 CCACTCTGTACTCTATTTATA pLKO_005 1304 CDS 100% 15.000 10.500 N Gpr19 n/a
6 TRCN0000328127 TCTGCATGTCCTCGATGAAAT pLKO_005 1358 CDS 100% 13.200 9.240 N Gpr19 n/a
7 TRCN0000328193 TCTTGGTGGGCTTCGTGATTC pLKO_005 1007 CDS 100% 10.800 7.560 N Gpr19 n/a
8 TRCN0000028189 CCTGCTCTTGAACCTAGTGTT pLKO.1 1158 CDS 100% 4.950 3.465 N Gpr19 n/a
9 TRCN0000028174 CGTGGGTATCTTTCAGCTCTT pLKO.1 1271 CDS 100% 4.050 2.835 N Gpr19 n/a
10 TRCN0000028198 CCCACTCTGTACTCTATTTAT pLKO.1 1303 CDS 100% 15.000 9.000 N Gpr19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487695 GAATTTATTGACATATCTATAATT pLX_317 21.8% 83.1% 89.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487692 AAAGTACCAAGCGGCCGTTTACCG pLX_317 21.8% 82.9% 89.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488209 ACGTATTACATCCCTGAGGGAATT pLX_317 29.4% 82.8% 88.9% V5 (many diffs) n/a
Download CSV