Construct: ORF TRCN0000487692
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020853.1_s317c1
- DNA Barcode:
- AAAGTACCAAGCGGCCGTTTACCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR19 (2842)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487692
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2842 | GPR19 | G protein-coupled receptor 19 | NM_006143.3 | 99.8% | 99.7% | 565G>A;1080C>T |
| 2 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_011520625.2 | 99.8% | 99.7% | 565G>A;1080C>T |
| 3 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_017019216.2 | 99.8% | 99.7% | 565G>A;1080C>T |
| 4 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_011520623.3 | 95.4% | 95.3% | 1_57del;622G>A;1137C>T |
| 5 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_011520624.2 | 95.4% | 95.3% | 1_57del;622G>A;1137C>T |
| 6 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_017019212.1 | 95.4% | 95.3% | 1_57del;622G>A;1137C>T |
| 7 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_017019213.1 | 95.4% | 95.3% | 1_57del;622G>A;1137C>T |
| 8 | human | 2842 | GPR19 | G protein-coupled receptor 19 | XM_017019214.1 | 95.4% | 95.3% | 1_57del;622G>A;1137C>T |
| 9 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_001167694.2 | 82.9% | 89.3% | (many diffs) |
| 10 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_001167697.2 | 82.9% | 89.3% | (many diffs) |
| 11 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_001167699.2 | 82.9% | 89.3% | (many diffs) |
| 12 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_001167695.2 | 81.5% | 87.9% | (many diffs) |
| 13 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_001167696.2 | 81.5% | 87.9% | (many diffs) |
| 14 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_001167700.2 | 81.5% | 87.9% | (many diffs) |
| 15 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | NM_008157.3 | 81.5% | 87.9% | (many diffs) |
| 16 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_006505554.1 | 81.5% | 87.9% | (many diffs) |
| 17 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_017321393.1 | 81.5% | 87.9% | (many diffs) |
| 18 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_017321391.1 | 70% | 75.4% | (many diffs) |
| 19 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_017321392.1 | 70% | 75.4% | (many diffs) |
| 20 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_006505543.3 | 68.8% | 74% | (many diffs) |
| 21 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_006505544.3 | 68.8% | 74% | (many diffs) |
| 22 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_006505545.2 | 68.8% | 74% | (many diffs) |
| 23 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_006505547.3 | 68.8% | 74% | (many diffs) |
| 24 | mouse | 14760 | Gpr19 | G protein-coupled receptor 19 | XM_017321390.1 | 68.8% | 74% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1317
- ORF length:
- 1245
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggttttt gctcacagaa tggataacag caagccacat ttgattattc 121 ctacacttct ggtgcccctc caaaaccgca gctgcactga aacagccaca cctctgccaa 181 gccaatacct gatggaatta agtgaggagc acagttggat gagcaaccaa acagaccttc 241 actatgtgct gaaacccggg gaagtggcca cagccagcat cttctttggg attctgtggt 301 tgttttctat cttcggcaat tccctggttt gtttggtcat ccataggagt aggaggactc 361 agtctaccac caactacttt gtggtctcca tggcatgtgc tgaccttctc atcagcgttg 421 ccagcacgcc tttcgtcctg ctccagttca ccactggaag gtggacgctg ggtagtgcaa 481 cgtgcaaggt tgtgcgatat tttcaatatc tcactccagg tgtccagatc tacgttctcc 541 tctccatctg catagaccgg ttctacacca tcgtctatcc tctgagcttc aaggtgtcca 601 gagaaaaagc caagaaaatg attgcggcat cgtggatctt tgatgcaggc tttgtgaccc 661 ctgtgctctt tttctatggc tccaactggg acagtcattg taactatttc ctcccctcct 721 cttgggaagg cactgcctac actgtcatcc acttcttggt gggctttgtg attccatctg 781 tcctcataat tttattttac caaaaggtca taaaatatat ttggagaata ggcacagatg 841 gccgaacggt gaggaggaca atgaacattg tccctcggac aaaagtgaaa actatcaaga 901 tgttcctcat tttaaatctg ttgtttttgc tctcctggct gccttttcat gtagctcagc 961 tatggcaccc ccatgaacaa gactataaga aaagttccct tgttttcaca gctatcacat 1021 ggatatcctt tagttcttca gcctctaaac cTACTCTGTA TTCAATTTAT AATGCCAATT 1081 TTCGGAGAGG GATGAAAGAG ACTTTTTGCA TGTCCTCTAT GAAATGTTAC CGAAGCAATG 1141 CCTATACTAT TACAACAAGT TCAAGGATGG CCAAAAAAAA CTACGTTGGC ATTTCAGAAA 1201 TCCCTTCCAT GGCCAAAACT ATTACCAAAG ACTCGATCTA TGACTCATTT GACAGAGAAG 1261 CCAAGGAAAA AAAGCTTGCT TGGCCCATTA ACTCAAATCC ACCAAATACT TTTGTCTAGA 1321 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1381 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1441 TTTATATATC TTGTGGAAAG GACGAAAAGT ACCAAGCGGC CGTTTACCGA CGCGTTAAGT 1501 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt